Journal: International Journal of Molecular Sciences

Article Title: Fukutin Protein Participates in Cell Proliferation by Enhancing Cyclin D1 Expression through Binding to the Transcription Factor Activator Protein-1: An In Vitro Study

doi: 10.3390/ijms222212153

Figure Lengend Snippet: The principle ( A ) and results ( B , C ) of ELISA to validate fukutin binding to cyclin D1 promoter in total protein extracts obtained from 1321N1 cell lysate samples. ( A ) Prior to experiments, a microplate is coated with an anti-fukutin antibody. The antibody traps fukutin protein in the samples. Digoxigenin (DIG)-labeled oligonucleotide DNA probes, designated for the entire cyclin D1 promoter region and for the AP-1 binding site on the cyclin D1 promoter, are predicted to bind to the fukutin. Successful binding is detected with an alkaline phosphatase-labeled anti-DIG antibody and visualized using an enzyme reaction yellow product. The obtained values are subjected to statistical comparison. ( B ) The fukutin/entire promoter region complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). ( C ) The fukutin/AP-1 binding site complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). All experiments were conducted in triplicate.

Article Snippet: Oligonucleotide primer sets for cyclin D1 promoter entire region (sense, 5′–GTTTAATTGATAATTGTTCT–3′; antisense, 5′–CGGCTCTCGCTTCTGCTGCC–3′) and 5′-sided one-third portion of the cyclin D1 promoter region (sense, 5′–GTTTAATTGATAATTGTTCT–3′; antisense, 5′–AACCGGGAGAAACACACCTC–3′) were synthesized by Thermo Fisher Scientific.

Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Labeling, Comparison